Strain Information | |
---|---|
DGRC Number | 112001 |
Genotype with FlyBase Link | w[*]; P{w[+mW.hs]=GawB}NP0001 / CyO, P{w[-]=UAS-lacZ.UW14}UW14 |
Genotype | w*; P{w+mW.hs=GawB}NP0001 / CyO, P{w-=UAS-lacZ.UW14}UW14 |
Break points/Insertion Site | 31F4 |
Map Viewer | |
Related Genes | CG13144 CG6094 Myo31DF |
Original Number | 1 |
Chromosome | 2 |
Comments | FlyBase Insertion: P{GawB}NP0001 NP line. Received from the National Institute of Genetics. |
Balancer | CyUW14 |
Cluster id | 1151 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Embryonic Expression | a small # of cells, hg |
Larval GFP | gut |
Larval X-gal | gut |
Adult GFP | abdomen |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Li SS, Li AQ, Liu ZY, Zhao XY, Wang GR, Deng Y, Wang QP. Glutamine enhances sucrose taste through a gut microbiota-gut-brain axis in Drosophila. Life Sci (2024) 339 122415 [PubMed ID = 38218533] [RRC reference] Fuse N, Hashiba H, Ishibashi K, Suzuki T, Nguyen QD, Fujii K, Ikeda-Ohtsubo W, Kitazawa H, Tanimoto H, Kurata S. Neural control of redox response and microbiota-triggered inflammation in Drosophila gut. Front Immunol (2023) 14 1268611 [PubMed ID = 37965334] [RRC reference] Nicolson S, Manning JA, Lim Y, Jiang X, Kolze E, Dayan S, Umargamwala R, Xu T, Sandow JJ, Webb AI, Kumar S, Denton D. The Drosophila ZNRF1/2 homologue, detour, interacts with HOPS complex and regulates autophagy. Commun Biol (2024) 7(1) 183 [PubMed ID = 38360932] [RRC reference] Ikegawa Y, Combet C, Groussin M, Navratil V, Safar-Remali S, Shiota T, Aouacheria A, Yoo SK. Evidence for existence of an apoptosis-inducing BH3-only protein, sayonara, in Drosophila. EMBO J (2023) 42(8) e110454 [PubMed ID = 36727601] [RRC reference] Aggarwal P, Liu Z, Cheng GQ, Singh SR, Shi C, Chen Y, Sun LV, Hou SX. Disruption of the lipolysis pathway results in stem cell death through a sterile immunity-like pathway in adult Drosophila. Cell Rep (2022) 39(12) 110958 [PubMed ID = 35732115] [RRC reference] Takemura M, Bowden N, Lu YS, Nakato E, O'Connor MB, Nakato H. Drosophila MOV10 regulates the termination of midgut regeneration. Genetics (2021) 218(1) [PubMed ID = 33693718] [RRC reference] Shen JL, Fortier TM, Zhao YG, Wang R, Burmeister M, Baehrecke EH. Vmp1, Vps13D, and Marf/Mfn2 function in a conserved pathway to regulate mitochondria and ER contact in development and disease. Curr Biol (2021) 31(14) 3028-3039.e7 [PubMed ID = 34019822] [RRC reference] Dong W, Zhang X, Kong Y, Zhao Z, Mahmoud A, Wu L, Moussian B, Zhang J. CYP311A1 in the anterior midgut is involved in lipid distribution and microvillus integrity in Drosophila melanogaster. Cell Mol Life Sci (2022) 79(5) 261 [PubMed ID = 35478270] [RRC reference] Bjedov I, Cocheme HM, Foley A, Wieser D, Woodling NS, Castillo-Quan JI, Norvaisas P, Lujan C, Regan JC, Toivonen JM, Murphy MP, Thornton J, Kinghorn KJ, Neufeld TP, Cabreiro F, Partridge L. Fine-tuning autophagy maximises lifespan and is associated with changes in mitochondrial gene expression in Drosophila. PLoS Genet (2020) 16(11) e1009083 [PubMed ID = 33253201] [RRC reference] Nagai H, Tatara H, Tanaka-Furuhashi K, Kurata S, Yano T. Homeostatic Regulation of ROS-Triggered Hippo-Yki Pathway via Autophagic Clearance of Ref(2)P/p62 in the Drosophila Intestine. Dev Cell (2021) 56(1) 81-94.e10 [PubMed ID = 33400912] [RRC reference] Izumi Y, Furuse K, Furuse M. The novel membrane protein Hoka regulates septate junction organization and stem cell homeostasis in the Drosophila gut. J Cell Sci (2021) 134(6) [PubMed ID = 33589496] [RRC reference] Hudry B, de Goeij E, Mineo A, Gaspar P, Hadjieconomou D, Studd C, Mokochinski JB, Kramer HB, Placais PY, Preat T, Miguel-Aliaga I. Sex Differences in Intestinal Carbohydrate Metabolism Promote Food Intake and Sperm Maturation. Cell (2019) 178(4) 901-918.e16 [PubMed ID = 31398343] [RRC reference] Kim J, Kim H, Noh SH, Jang DG, Park SY, Min D, Kim H, Kweon HS, Kim H, Aum S, Seo S, Choi CS, Kim H, Kim JW, Moon SJ, Gee HY, Lee MG. Grasp55-/- mice display impaired fat absorption and resistance to high-fat diet-induced obesity. Nat Commun (2020) 11(1) 1418 [PubMed ID = 32184397] [RRC reference] Nagai H, Kurata S, Yano T. Immunoglobulin superfamily beat-Ib mediates intestinal regeneration induced by reactive oxygen species in Drosophila. Genes Cells (2020) 25(5) 343-349 [PubMed ID = 32080940] [RRC reference] Redhai S, Pilgrim C, Gaspar P, Giesen LV, Lopes T, Riabinina O, Grenier T, Milona A, Chanana B, Swadling JB, Wang YF, Dahalan F, Yuan M, Wilsch-Brauninger M, Lin WH, Dennison N, Capriotti P, Lawniczak MKN, Baines RA, Warnecke T, Windbichler N, Leulier F, Bellono NW, Miguel-Aliaga I. An intestinal zinc sensor regulates food intake and developmental growth. Nature (2020) 580(7802) 263-268 [PubMed ID = 32269334] [RRC reference] Izumi Y, Furuse K, Furuse M. Septate junctions regulate gut homeostasis through regulation of stem cell proliferation and enterocyte behavior in Drosophila. J Cell Sci (2019) 132(18) [PubMed ID = 31444286] [RRC reference] Anding AL, Wang C, Chang TK, Sliter DA, Powers CM, Hofmann K, Youle RJ, Baehrecke EH. Vps13D Encodes a Ubiquitin-Binding Protein that Is Required for the Regulation of Mitochondrial Size and Clearance. Curr Biol (2018) 28(2) 287-295.e6 [PubMed ID = 29307555] [RRC reference] Kurz CL, Charroux B, Chaduli D, Viallat-Lieutaud A, Royet J. Peptidoglycan sensing by octopaminergic neurons modulates Drosophila oviposition. Elife (2017) 6 [PubMed ID = 28264763] [RRC reference] Dasari SK, Schejter E, Bialik S, Shkedy A, Levin-Salomon V, Levin-Zaidman S, Kimchi A. Death by over-eating: The Gaucher disease associated gene GBA1, identified in a screen for mediators of autophagic cell death, is necessary for developmental cell death in Drosophila midgut. Cell Cycle (2017) 16(21) 2003-2010 [PubMed ID = 28933588] [RRC reference] Sun T, Song Y, Dai J, Mao D, Ma M, Ni JQ, Liang X, Pastor-Pareja JC. Spectraplakin Shot Maintains Perinuclear Microtubule Organization in Drosophila Polyploid Cells. Dev Cell (2019) 49(5) 731-747.e7 [PubMed ID = 31006649] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np51725_0227 |
Strand | Minus |
Insertion Point | 10499195 |
Chromosome Band | 2L |
Flanking Sequence | ggtttttggtgcactgaccttaagtgtatacttcggtaagcttcggctatcgacgggacc accttatgttatttcatcatgGTCTGACCACAGTCCCTCTGCAACTTTCATTGAATGCGG TCGAGTGCGGTTGTGCGACGGCCGATTGTTGTTATTAATCCGCCGCAAACGAAACTGAAT CCAGGTGGGCACTCACACCGATCNAAGAATACATANGAGAGAACCGTNNNCAANGAACCC ATTATTGNTGGGGTNCGTNTTCAGGAAGGGCAAGCCATCCGACATGTGATCCTCTTNAGA CCAATCAAATCCATGAAGAGCATNCNTGGGCATAAAATCCAACGGAATTGTGGAGTTATC ATGATGAGCTGCCGAGTCAATCGATACAGTCAACTGTCTTTGACCTTTGTTACTACTCTC TTCCGATGATGATGTCGCACTTATTCTATGCTGTCTCAATGTTAGAGGCATATCAGTCTC CACTGAAGCCATCTTATTCTGGATGACNAGCTGNCGAGGNANATGATNCACTCANCTGNT GCTGACCTNAGGTACTACTCTTTTCNGATGATGATGTAGCNCTTATTTTATGCTGNCTNA ATGNTAGAGGCATATCANNNTNCACTGAAGCCAATNTNNTNTGNNNNNNNNTNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnntn |
Image Files | ||
---|---|---|
Disc |
|